Mesenchymal stem cells and three-dimensional-osteoconductive scaffold regenerate calvarial bone in critical size defects in swine

Craniofacial bones shield important organs, carry out necessary physiological capabilities, and form facial identification. Crucial-size defects (CSDs) in calvarial bones, which won’t heal spontaneously, are brought on by trauma, congenital defects, or tumor resections. They pose an excellent problem for sufferers and physicians, and considerably compromise high quality of life. At the moment, calvarial CSDs are handled both by allogenic or autologous grafts, steel or different artificial plates which can be related to appreciable problems.

Whereas earlier research have explored tissue regeneration for calvarial defects, most have been achieved in small animal fashions with restricted translational worth. Right here we outline a swine calvarial CSD mannequin and present a novel strategy to regenerate high-quality bone in these defects by combining mesenchymal stem cells (MSCs) with a three-dimensional (3D)-printed osteoconductive HA/TCP scaffold. Particularly, we’ve in contrast the efficiency of dental pulp neural crest MSCs (DPNCCs) to bone marrow aspirate (BMA) mixed with a 3D-printed HA/TCP scaffold to regenerate bone in a calvarial CSD (>7.zero cm² ).

Each DPNCCs and BMA loaded onto the 3D-printed osteoconductive scaffold assist the regeneration of calvarial bone with density, compression energy, and trabecular buildings much like native bone. Our examine demonstrates a novel utility of an unique scaffold design mixed with DPNCCs or BMA to assist regeneration of high-quality bone in a newly outlined and clinically related swine calvarial CSD mannequin. This discovery might have necessary influence on bone regeneration past the craniofacial area and can finally profit sufferers who are suffering from debilitating CSDs.  Bacillus ancthracis causes cutaneous, pulmonary, or gastrointestinal types of anthrax. B. anthracis is a pathogenic bacterium that’s doubtlessly for use in bioterrorism as a result of it may be produced within the type of spores.

At the moment, protecting antigen (PA)-based vaccines are getting used for the prevention of anthrax, however it’s essential to develop extra secure and efficient vaccines attributable to their extended immunization schedules and hostile reactions. We chosen the lipoprotein GBAA0190, a potent inducer of host immune response, current in anthrax spores as a novel potential vaccine candidate. Then, we evaluated its immune-stimulating exercise within the bone marrow-derived macrophages (BMDMs) utilizing enzyme-linked immunosorbent assay (ELISA) and Western blot evaluation. Protecting efficacy of GBAA0190 was evaluated within the guinea pig (GP) mannequin.

Printing 3D vagina tissue analogues with vagina decellularized extracellular matrix bioink

Quite a lot of elements may cause vaginal loss. The sufferers are affected by nice psychological and bodily ache, and there may be an pressing want for vagina reconstruction. 3D-bioprinting is anticipated to attain vaginal morphological restoration and true useful reconstruction. The present examine aimed to discover the biomimetic 3D vagina tissue printing with acellular vagina matrix (AVM) bioink. The AVM from pig was transformed to bioink by 15% gelatin and three% sodium alginate combined with the AVM resolution.

Rheology, scanning electron microscopy and HE staining have been carried out to characterize the bioink’s viscosity, morphologies and biocompatibility. After printing, the viability of bone marrow mesenchymal stem cells (BMSCs) within the printed 3D scaffolds in vitro was investigated by a reside/useless assay equipment. Then, subcutaneous transplantation in rats have been divided randomly into 3D scaffold group and 3D scaffold encapsulating CM-Dil-labeled BMSCs group.

The outcomes of HE, immunohistochemistry and immunofluorescence staining revealed that 3D scaffold encapsulating BMSCs expressed vital results on the vascularization and epithelization of the printed vagina tissue, and the BMSCs might purchase the phenotype of vaginal epithelial cells and endothelial-like cells. The work confirmed that the biomimetic 3D vagina tissue with AVM bioink encapsulating BMSCs is a promising strategy for vagina reconstruction.

Pig-a gene mutations in bone marrow granulocytes of procarbazine-treated F344 rats

We beforehand demonstrated that procarbazine (PCZ) is constructive within the rat erythrocyte Pig-a gene mutation assay. Nevertheless, since mammalian erythrocytes lack genomic DNA, it was mandatory to research nucleated bone–marrow erythroid precursor cells to verify that PCZ induces mutations within the Pig-a gene (Revollo et al., Environ Mol Mutagen, 2020). On this examine we additional strengthened the affiliation between Pig-a mutation and lack of GPI anchors and evaluated the genesis of Pig-a mutation in PCZ-dosed rats by analyzing bone–marrow granulocytes.

Erythrocytes and granulocytes each originate from myeloid progenitor cells, however granulocytes comprise DNA all through their developmental phases. F344 rats have been handled with three doses of 150 mg/kg PCZ; two weeks later, CD48-deficient mutant phenotype bone–marrow granulocytes (BMGs (CD11b⁺ )) have been remoted by flow-cytometric sorting. Sequencing information confirmed that the CD48-deficient mutant phenotype BMGs contained mutations within the Pig-a gene whereas wild-type BMGs didn’t. PCZ-induced mutations included missense, nonsense and splice website variants; nearly all of mutations have been A>T, A>C and A>G, with the mutated A on the non-transcribed DNA strand.

CCL5 ELISA Kit (Guinea Pig) (OKDD00503)
OKDD00503	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: Chemoattractant for blood monocytes, memory T-helper cells and eosinophils. Causes the release of histamine from basophils and activates eosinophils. May activate several chemokine receptors including CCR1, CCR3, CCR4 and CCR5. May also be an agonist of the G protein-coupled receptor GPR75. Together with GPR75, may play a role in neuron survival through activation of a downstream signaling pathway involving the PI3, Akt and MAP kinases. By activating GPR75 may also play a role in insulin secretion by islet cells.;Species reactivity: Guinea Pig;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.059 ng/mL

Guinea pig C-C motif chemokine 5(CCL5) ELISA kit
CSB-EL004800GU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Guinea pig C-C motif chemokine 5 (CCL5) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Guinea pig C-C motif chemokine 5(CCL5) ELISA kit
1-CSB-EL004800GU	Cusabio	EUR 602.00 EUR 4238.00 EUR 2256.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Guinea pig C-C motif chemokine 5(CCL5) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pig RANTES (CCL5) ELISA Kit
20-abx154995	Abbexa	EUR 7645.00 EUR 4074.00 EUR 942.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Pig RANTES (CCL5) ELISA Kit
abx361827-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig RANTES (CCL5) ELISA Kit
abx575250-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

CCL5 ELISA Kit (Pig) (OKCD01106)
OKCD01106	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 1.15 ng/mL

CCL5 ELISA Kit (Pig) (OKCA02513)
OKCA02513	Aviva Systems Biology	96 Wells	EUR 930
Description: Description of target: Chemoattractant for blood monocytes, memory T-helper cells and eosinophils. Causes the release of histamine from basophils and activates eosinophils. May activate several chemokine receptors including CCR1, CCR3, CCR4 and CCR5. May also be an agonist of the G protein-coupled receptor GPR75. Together with GPR75, may play a role in neuron survival through activation of a downstream signaling pathway involving the PI3, Akt and MAP kinases. By activating GPR75 may also play a role in insulin secretion by islet cells.;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.078 ng/mL

CCL5 ELISA Kit (Pig) (OKEH07307)
OKEH07307	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 19.5pg/mL

Recombinant Human Rantes (CCL5)
7-02080	CHI Scientific	5µg	Ask for price

Recombinant Human Rantes (CCL5)
7-02081	CHI Scientific	20µg	Ask for price

Recombinant Human Rantes (CCL5)
7-02082	CHI Scientific	1mg	Ask for price

Recombinant Mouse Rantes (CCL5)
7-02086	CHI Scientific	5µg	Ask for price

Recombinant Mouse Rantes (CCL5)
7-02087	CHI Scientific	20µg	Ask for price

Recombinant Mouse Rantes (CCL5)
7-02088	CHI Scientific	1mg	Ask for price

Recombinant Rat Rantes (CCL5)
7-02089	CHI Scientific	5µg	Ask for price

Recombinant Rat Rantes (CCL5)
7-02090	CHI Scientific	20µg	Ask for price

Recombinant Rat Rantes (CCL5)
7-02091	CHI Scientific	1mg	Ask for price

Bovine CCL5 Recombinant Protein
R00617	BosterBio	5ug/vial	EUR 259
Description: CCL5, also known as RANTES (regulated and normal T cell expressed and secreted), is a member of the C-C Chemokine Family. RANTES (CCL5) is chemotactic for T cells, eosinophils, and basophils, and plays an active role in recruiting leukocytes into inflammatory sites. Bovine CCL5 Recombinant Protein is purified CCL5 (RANTES) produced in yeast.

Canine CCL5 Recombinant Protein
R00617-1	BosterBio	5ug/vial	EUR 259
Description: CCL5, also known as RANTES (regulated and normal T cell expressed and secreted), is a member of the C-C Chemokine Family. RANTES (CCL5) is chemotactic for T cells, eosinophils, and basophils, and plays an active role in recruiting leukocytes into inflammatory sites. Canine CCL5 Recombinant Protein is purified CCL5 (RANTES) produced in yeast.

Equine CCL5 Recombinant Protei
R00617-2	BosterBio	5ug/vial	EUR 259
Description: CCL5, also known as RANTES (regulated and normal T cell expressed and secreted), is a member of the C-C Chemokine Family. RANTES (CCL5) is chemotactic for T cells, eosinophils, and basophils, and plays an active role in recruiting leukocytes into inflammatory sites. Equine CCL5 Recombinant Protein is purified CCL5 (RANTES) produced in yeast.

Swine CCL5 Recombinant Protein
R00617-4	BosterBio	5ug/vial	EUR 259
Description: CCL5, also known as RANTES (regulated and normal T cell expressed and secreted), is a member of the C-C Chemokine Family. RANTES (CCL5) is chemotactic for T cells, eosinophils, and basophils, and plays an active role in recruiting leukocytes into inflammatory sites. Swine CCL5 Recombinant Protein is purified CCL5 (RANTES) produced in yeast.

ELISA kit for Guinea pig C-C motif chemokine 5 (CCL5)
EK0098	SAB	96 tests	EUR 712
Description: Enzyme-linked immunosorbent assay kit for quantification of Guinea pig C-C motif chemokine 5 (CCL5) in samples from serum, plasma, tissue homogenates and other biological fluids.

Rantes Rat Recombinant Protein (CCL5)
PROTP50231	BosterBio	Regular: 20ug	EUR 317
Description: Rantes Rat Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 68 amino acids and having a molecular mass of 7876 Dalton. ;The Rat Rantes is purified by proprietary chromatographic techniques.

Recombinant Rat RANTES (CCL5) Protein
PROTP50231-1	BosterBio	20ug	EUR 317
Description: RANTES is a protein which has been shown to be a chemoattractant for peripheral blood monocytes. It appears to selectively attract T cells of the CD4+/CD45RO+ phenotype in vitro. Recombinant Rat RANTES is a 7.9 kDa protein containing 68 amino acid residues.

Rantes Human Recombinant Protein (CCL5)
PROTP13501	BosterBio	Regular: 20ug	EUR 317
Description: Rantes Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 68 amino acids and having a molecular mass of 7809.2 Dalton. ;The Rantes is purified by proprietary chromatographic techniques.

Recombinant Human RANTES (CCL5) Protein
PROTP13501-2	BosterBio	20ug	EUR 317
Description: RANTES is a CC-chemokine that can signal through the CCR1, CCR3, CCR5 and US28 (cytomegalovirus receptor) receptors. It is a chemoattractant towards monocytes, memory T cells (CD4+/CD45RO), basophils, and eosinophils. RANTES also has the capability to inhibit certain strains of HIV-1, HIV-2 and simian immunodeficiency virus (SIV). Recombinant human RANTES is a 7.8 kDa protein containing 68 amino acid residues including the four highly conserved cysteine residues present in the CC chemokines.

Rantes Mouse Recombinant Protein (CCL5)
PROTP30882	BosterBio	Regular: 20ug	EUR 317
Description: Rantes Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 68 amino acids and having a molecular mass of 7.8kDa. ;The Mouse Rantes is purified by proprietary chromatographic techniques.

Recombinant Murine RANTES (CCL5) Protein
PROTP30882-1	BosterBio	20ug	EUR 317
Description: RANTES is a CC-chemokine that can signal through the CCR1, CCR3, CCR5 and US28 (cytomegalovirus receptor) receptors. It is a chemoattractant towards monocytes, memory T cells (CD4+/CD45RO), basophils, and eosinophils. RANTES also has the capability to inhibit certain strains of HIV-1, HIV-2 and simian immunodeficiency virus (SIV). Recombinant murine RANTES is a 7.8 kDa protein containing 68 amino acid residues including the four highly conserved cysteine residues present in the CC chemokines.

Recombinant (E.Coli) Human Rantes (CCL5)
RP-1030	Alpha Diagnostics	5 ug	EUR 164

Recombinant Human CCL5/RANTES Protein
RP00321	Abclonal	10 μg	EUR 193

Recombinant Guinea Pig TNFA
P0155	FN Test	100ug	EUR 522.36
Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose Reconstitution: Sterile distilled water Purity: Greater than 95% by SDS-PAGE gel analyses Uniprot ID: P51435
Description: Recombinant Guinea protein for TNFA

Recombinant Guinea Pig CCL2
P0159	FN Test	100ug	EUR 522.36
Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose Reconstitution: Sterile distilled water Purity: Greater than 95% by SDS-PAGE gel analyses Uniprot ID: Q08782
Description: Recombinant Guinea protein for Pig CCL2

CCL5 antibody
20R-1137	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal CCL5 antibody

CCL5 antibody
70R-15221	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal CCL5 antibody

CCL5 Antibody
32935-100ul	SAB	100ul	EUR 252

CCL5 antibody
10R-6630	Fitzgerald	100 ug	EUR 284
Description: Mouse monoclonal CCL5 antibody

CCL5 Antibody
1-CSB-PA05955A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL5. Recognizes CCL5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

CCL5 Antibody
1-CSB-PA05959A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL5. Recognizes CCL5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

CCL5 Antibody
DF7427	Affbiotech	200ul	EUR 304
Description: CCL5 Antibody detects endogenous levels of total CCL5.

CCL5 Antibody
1-CSB-PA040300	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCL5. Recognizes CCL5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.IHC:1/200-1/1000.ELISA:1/40000

CCL5 siRNA
20-abx900873	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CCL5 siRNA
20-abx910794	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CCL5 siRNA
20-abx910795	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CCL5 Antibody
ABD7427	Lifescience Market	100 ug	EUR 438

Recombinant Human Rantes (CCL5) His Tag
7-02083	CHI Scientific	2µg	Ask for price

Recombinant Human Rantes (CCL5) His Tag
7-02084	CHI Scientific	10µg	Ask for price

Recombinant Human Rantes (CCL5) His Tag
7-02085	CHI Scientific	1mg	Ask for price

Rantes Rhesus Macaque Recombinant Protein (CCL5)
PROTQ8HYQ1	BosterBio	Regular: 20ug	EUR 317
Description: Rantes Rhesus Macaque Recombinant produced in E.coli is a single, non-glycosylated, polypeptide chain containing 68 amino acids and having a molecular mass of 7.8kDa.;The CCL5 is purified by proprietary chromatographic techniques.

Recombinant Guinea Pig IL-8
P0179	FN Test	100ug	EUR 522.36
Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose Reconstitution: Sterile distilled water Purity: Greater than 95% by SDS-PAGE gel analyses Uniprot ID: P49113
Description: Recombinant Guinea protein for IL-8

Recombinant Guinea Pig IL-1b
P0281	FN Test	100ug	EUR 522.36
Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose Reconstitution: Sterile distilled water Purity: Greater than 95% by SDS-PAGE gel analyses Uniprot ID: Q9WVG1
Description: Recombinant Guinea protein for Pig IL-1b

Guinea Pig CCL11 Recombinant Protein
R01438-2	BosterBio	5ug/vial	EUR 259
Description: Chemokine ligand 11 (CCL11) belongs to the CC chemokine family and is commonly known as Eotaxin-1. CCL11 (Eotaxin-1) selectively recruits eosinophils by inducing their chemotaxis, and therefore, is implicated in allergic responses. Guinea Pig CCL11 Recombinant Protein is purified chemokine ligand 11 (CCL11, Eotaxin-1) produced in yeast.

Guinea Pig CCL2 Recombinant Protein
R00056-3	BosterBio	5ug/vial	EUR 259
Description: Chemokine (C-C motif) ligand 2 (CCL2), also known as monocyte chemotactic protein-1 (MCP-1), is a small cytokine belonging to the CC chemokine family. CCL2 (MCP-1) recruits monocytes, memory T cells, and dendritic cells to sites of tissue injury and infection. Guinea Pig CCL2 (MCP-1) Recombinant Protein is purified CCL2 (MCP-1) produced in yeast.

Guinea Pig CXCL1 Recombinant Protein
R00533	BosterBio	5ug/vial	EUR 259
Description: Chemokine (C-X-C motif) Ligand 1 (CXCL1) is part of the CXC family of chemotactic cytokines. CXCL1 is a chemoattractant for neutrophils, plays a role in spinal cord development, and is involved in the processes of angiogenesis, inflammation, wound healing, and tumorigenesis. Guinea Pig CXCL1 Recombinant Protein is purified CXCL1 produced in yeast.

CCL5 protein (Mouse)
30R-2225	Fitzgerald	25 ug	EUR 349
Description: Purified recombinant Mouse CCL5 protein

CCL5 protein (Mouse)
30R-2286	Fitzgerald	100 ug	EUR 932
Description: Purified recombinant Mouse CCL5 protein

CCL5 Rabbit pAb
A14192-100ul	Abclonal	100 ul	EUR 308

CCL5 Rabbit pAb
A14192-200ul	Abclonal	200 ul	EUR 459

CCL5 Rabbit pAb
A14192-20ul	Abclonal	20 ul	EUR 183

CCL5 Rabbit pAb
A14192-50ul	Abclonal	50 ul	EUR 223

CCL5 Blocking Peptide
33R-10110	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCL5 antibody, catalog no. 20R-1137

CCL5 antibody (HRP)
60R-1507	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal CCL5 antibody (HRP)

CCL5 antibody (FITC)
60R-1508	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal CCL5 antibody (FITC)

CCL5 antibody (biotin)
60R-1509	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal CCL5 antibody (biotin)

CCL5 Blocking Peptide
DF7427-BP	Affbiotech	1mg	EUR 195

RANTES (CCL5) Antibody
20-abx109628	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RANTES (CCL5) Antibody
20-abx109629	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rantes (CCL5) Protein
20-abx261581	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Rantes (CCL5) Protein
20-abx261592	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Rantes (CCL5) Protein
20-abx261595	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

CCL5 Conjugated Antibody
C32935	SAB	100ul	EUR 397

RANTES (CCL5) Antibody
20-abx326815	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Rantes (CCL5) Protein
20-abx262275	Abbexa	EUR 328.00 EUR 5924.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

CCL5 cloning plasmid
CSB-CL004800HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 276 Sequence: atgaaggtctccgcggcagccctcgctgtcatcctcattgctactgccctctgcgctcctgcatctgcctccccatattcctcggacaccacaccctgctgctttgcctacattgcccgcccactgccccgtgcccacatcaaggagtatttctacaccagtggcaagtgctccaa Show more
Description: A cloning plasmid for the CCL5 gene.

CCL5 Polyclonal Antibody
A51637	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

CCL5 Polyclonal Antibody
A52420	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

RANTES/CCL5, Human
HY-P7283	MedChemExpress	50ug	EUR 497

Anti-CCL5 antibody
STJ27597	St John's Laboratory	100 µl	EUR 277
Description: This gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, functions as a chemoattractant for blood monocytes, memory T helper cells and eosinophils. It causes the release of histamine from basophils and activates eosinophils. This cytokine is one of the major HIV-suppressive factors produced by CD8+ cells. It functions as one of the natural ligands for the chemokine receptor chemokine (C-C motif) receptor 5 (CCR5), and it suppresses in vitro replication of the R5 strains of HIV-1, which use CCR5 as a coreceptor. Alternative splicing results in multiple transcript variants that encode different isoforms.

Anti-CCL5 antibody
STJ116125	St John's Laboratory	100 µl	EUR 277
Description: This gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, functions as a chemoattractant for blood monocytes, memory T helper cells and eosinophils. It causes the release of histamine from basophils and activates eosinophils. This cytokine is one of the major HIV-suppressive factors produced by CD8+ cells. It functions as one of the natural ligands for the chemokine receptor chemokine (C-C motif) receptor 5 (CCR5), and it suppresses in vitro replication of the R5 strains of HIV-1, which use CCR5 as a coreceptor. Alternative splicing results in multiple transcript variants that encode different isoforms.

RANTES, CCL5, human
RC315-16	Bio Basic	5ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

Guinea Pig TNF alpha Recombinant Protein
R00002-7	BosterBio	5ug/vial	EUR 259
Description: Tumor necrosis factor alpha (TNFSF2, TNF alpha) is a member of the TNF Superfamily. TNF alpha, being an endogenous pyrogen, is able to induce fever, to induce apoptotic cell death, to induce sepsis (through IL-1 & IL-6 production), to induce cachexia, induce inflammation, and to inhibit tumorigenesis and viral replication. Guinea Pig TNF alpha Recombinant Protein is purified TNF alpha (TNFSF2) produced in yeast.

Guinea Pig IL-15 Recombinant Protein
R00212-2	BosterBio	5ug/vial	EUR 259
Description: Interleukin-15 (IL-15) is a cytokine with structural similarity to IL-2 that is secreted by mononuclear phagocytes following infection by virus(es). This cytokine induces cell proliferation of natural killer cells. Guinea Pig IL-15 Recombinant Protein is purified interleukin-15 produced in yeast.

Guinea Pig IL-8 Recombinant Protein
R00423-7	BosterBio	5ug/vial	EUR 259
Description: Interleukin-8 (IL-8), also known as CXCL8, is an ELR-positive CXC family member chemokine produced by macrophages and other cell types such as epithelial cells. ELR-positive CXC chemokines such as IL-8 specifically induce the migration of neutrophils, and interact with chemokine receptors CXCR1 and CXCR2. Guinea Pig IL-8 Recombinant Protein is purified interleukin-8 produced in yeast.

CCL5 Antibody, HRP conjugated
1-CSB-PA05955B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL5. Recognizes CCL5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCL5 Antibody, FITC conjugated
1-CSB-PA05955C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL5. Recognizes CCL5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCL5 Antibody, Biotin conjugated
1-CSB-PA05955D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL5. Recognizes CCL5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CCL5 Antibody, HRP conjugated
1-CSB-PA05959B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL5. Recognizes CCL5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCL5 Antibody, FITC conjugated
1-CSB-PA05959C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL5. Recognizes CCL5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCL5 Antibody, Biotin conjugated
1-CSB-PA05959D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL5. Recognizes CCL5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CCL5 protein (His tag)
80R-3347	Fitzgerald	50 ug	EUR 257
Description: Purified recombinant CCL5 protein (His tag)

RANTES (CCL5) Antibody (Biotin)
20-abx105241	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RANTES (CCL5) Antibody (Biotin)
20-abx105242	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RANTES (CCL5) Antibody (FITC)
20-abx106659	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RANTES (CCL5) Antibody (FITC)
20-abx106660	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RANTES (CCL5) Antibody (HRP)
20-abx108076	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RANTES (CCL5) Antibody (HRP)
20-abx108077	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human CCL5 ELISA Kit
ELA-E0116h	Lifescience Market	96 Tests	EUR 824

Mouse CCL5 shRNA Plasmid
20-abx972605	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat CCL5 shRNA Plasmid
20-abx986712	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CCL5 shRNA Plasmid
20-abx954286	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Anti-RANTES/CCL5 Antibody
PB9573	BosterBio	100ug/vial	EUR 294

RANTES, CCL5, murine (mouse)
RC235-16	Bio Basic	5ug	EUR 101.33
Product category: Proteins/Recombinant Proteins/Cytokines

Human, Rantes Human Recombinant Protein (CCL5), His Tag
PROTP13501-1	BosterBio	Regular: 10ug	EUR 317
Description: Rantes Human Recombinant produced in E.Coli is single, a non-glycosylated, Polypeptide chain containing 68 amino acids fragment (24-91) having a total molecular mass of 17.5kDa and fused with a 4.5kDa amino-terminal hexahistidine tag.;The Rantes His is purified by proprietary chromatographic techniques.

Recombinant Human CCL5/ RANTES Protein, Untagged, E.coli-100ug
QP10229-ec-100ug	EnQuireBio	100ug	EUR 988

Recombinant Human CCL5/ RANTES Protein, Untagged, E.coli-20ug
QP10229-ec-20ug	EnQuireBio	20ug	EUR 290

Recombinant Human CCL5/ RANTES Protein, Untagged, E.coli-250ug
QP10229-ec-250ug	EnQuireBio	250ug	EUR 1731

Recombinant Human CCL5/ RANTES Protein, Untagged, E.coli-5ug
QP10229-ec-5ug	EnQuireBio	5ug	EUR 154

Recombinant Mouse CCL5/ RANTES Protein, Untagged, E.coli-100ug
QP10265-ec-100ug	EnQuireBio	100ug	EUR 988

Recombinant Mouse CCL5/ RANTES Protein, Untagged, E.coli-20ug
QP10265-ec-20ug	EnQuireBio	20ug	EUR 290

Recombinant Mouse CCL5/ RANTES Protein, Untagged, E.coli-250ug
QP10265-ec-250ug	EnQuireBio	250ug	EUR 1731

Recombinant Mouse CCL5/ RANTES Protein, Untagged, E.coli-5ug
QP10265-ec-5ug	EnQuireBio	5ug	EUR 154

Recombinant Human CCL5/ RANTES Protein, Untagged, E.coli-1mg
QP5261-1mg	EnQuireBio	1mg	EUR 2856

Recombinant Human CCL5/ RANTES Protein, Untagged, E.coli-500ug
QP5261-500ug	EnQuireBio	500ug	EUR 1778

Recombinant Mouse CCL5/ RANTES Protein, Untagged, E.coli-1mg
QP5453-1mg	EnQuireBio	1mg	EUR 2856

Recombinant Mouse CCL5/ RANTES Protein, Untagged, E.coli-500ug
QP5453-500ug	EnQuireBio	500ug	EUR 1778

Recombinant Rat CCL5/ RANTES Protein, Untagged, E.coli-100ug
QP5513-100ug	EnQuireBio	100ug	EUR 490

Recombinant Rat CCL5/ RANTES Protein, Untagged, E.coli-1mg
QP5513-1mg	EnQuireBio	1mg	EUR 2856

Recombinant Rat CCL5/ RANTES Protein, Untagged, E.coli-20ug
QP5513-20ug	EnQuireBio	20ug	EUR 237

Recombinant Rat CCL5/ RANTES Protein, Untagged, E.coli-500ug
QP5513-500ug	EnQuireBio	500ug	EUR 1778

Recombinant Rat CCL5/ RANTES Protein, Untagged, E.coli-5ug
QP5513-5ug	EnQuireBio	5ug	EUR 136

Recombinant Human CCL5/ RANTES Protein, GST, E.coli-100ug
QP8524-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human CCL5/ RANTES Protein, GST, E.coli-10ug
QP8524-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human CCL5/ RANTES Protein, GST, E.coli-1mg
QP8524-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human CCL5/ RANTES Protein, GST, E.coli-200ug
QP8524-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human CCL5/ RANTES Protein, GST, E.coli-500ug
QP8524-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human CCL5/ RANTES Protein, GST, E.coli-50ug
QP8524-ec-50ug	EnQuireBio	50ug	EUR 263

Guinea Pig Albumin
30R-AG024	Fitzgerald	50 mg	EUR 381
Description: Sterile highly purified Guinea Pig albumin

Guinea Pig IgM
31C-CH0613	Fitzgerald	1 mg	EUR 414
Description: Purified Guinea Pig IgM

Guinea Pig Complement
37226-5	Pel-Freez	10mL	EUR 167
All products from Pel-Freez are available in Europe and worldwide via Gentaur. If you cannot find the item you need send us an inquiry and we will be in touch with you with pricing and delivery information in less than 12 hours.
Description: Whole blood is collected from healthy male and female guinea pigs from a US source. The animals showed no symptoms of any diseases at time of blood collection. The hemolytic titer hs slight Lot-to-Lot variation but is generally: CH50 > 400. Prior to working with it we recommend that the complement is thawed on ice or in a cold water bath or under a stream of cold water. Never thaw using warm or hot water. While defrosted like this we advise you to make single-use aliquots and keep them frozen at -70C. Freeze-thaw cycles will damage the complement components and will reduce significantly the activity. Once thawed, the leftover from a working aliquot should be discarded.

Neurotensin, guinea pig
5-01625	CHI Scientific	4 x 5mg	Ask for price

VIP, guinea pig
5-02079	CHI Scientific	4 x 1mg	Ask for price

VIP (guinea pig)
B5074-.2	ApexBio	200 ug	EUR 366

Guinea Pig HSV
EGH0317	Abclonal	96Tests	EUR 521

Guinea Pig HSV
EGH0318	Abclonal	96Tests	EUR 521

VIP (guinea pig)
H-5682.0500	Bachem	0.5mg	EUR 393
Description: Sum Formula: C147H239N43O42S2; CAS# [96886-24-7] net

Guinea Pig IL-1 beta Recombinant Protein
R00101-5	BosterBio	5ug/vial	EUR 259
Description: IL-1 beta (IL-1β) is a member of the interleukin 1 family of cytokines. The IL-1 beta cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1 (CASP1/ICE). This cytokine is an important mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis. Guinea Pig IL-1 beta Recombinant Protein is purified interleukin-1 beta cytokine produced in yeast.

Recombinant Human C-C Motif Chemokine 5/CCL5/RANTES
C062-10ug	Novoprotein	10ug	EUR 168
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human C-C Motif Chemokine 5/CCL5/RANTES
C062-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human C-C Motif Chemokine 5/CCL5/RANTES
C062-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human C-C Motif Chemokine 5/CCL5/RANTES
C062-50ug	Novoprotein	50ug	EUR 405
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Human CCL5 Detection Assay Kit
6822	Chondrex	1 kit	EUR 483.55
Description: Human CCL5 Detection Assay Kit

Polyclonal CCL5 antibody - middle region
APR00833G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCL5 - middle region. This antibody is tested and proven to work in the following applications:

Human RANTES (CCL5) ELISA Kit
abx050196-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-10 working days.

Mouse RANTES (CCL5) ELISA Kit
20-abx054945	Abbexa	EUR 5311.00 EUR 2837.00 EUR 668.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat RANTES (CCL5) ELISA Kit
20-abx156034	Abbexa	EUR 5374.00 EUR 2868.00 EUR 676.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse RANTES (CCL5) ELISA Kit
20-abx154601	Abbexa	EUR 5311.00 EUR 2837.00 EUR 668.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human RANTES (CCL5) ELISA Kit
20-abx152923	Abbexa	EUR 5374.00 EUR 2868.00 EUR 676.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse RANTES (CCL5) ELISA Kit
abx254540-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Monkey RANTES (CCL5) ELISA Kit
abx255394-96tests	Abbexa	96 tests	EUR 981
Shipped within 5-12 working days.

Rat RANTES (CCL5) ELISA Kit
abx255637-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human RANTES (CCL5) ELISA Kit
abx252029-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Rabbit RANTES (CCL5) ELISA Kit
abx362224-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken RANTES (CCL5) ELISA Kit
abx357058-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human RANTES (CCL5) ELISA Kit
abx570309-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Rat RANTES (CCL5) ELISA Kit
abx574660-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Dog RANTES (CCL5) ELISA Kit
abx575531-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Cow RANTES (CCL5) ELISA Kit
abx576357-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Dog RANTES (CCL5) ELISA Kit
abx511840-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Mouse RANTES (CCL5) ELISA Kit
abx511842-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

CCL5 Polyclonal Antibody, HRP Conjugated
A51638	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

CCL5 Polyclonal Antibody, FITC Conjugated
A51639	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

CCL5 Polyclonal Antibody, Biotin Conjugated
A51640	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

The PCZ-induced mutational evaluation in BMGs helps the affiliation between the phenotype measured within the Pig-a assay and mutation within the Pig-a gene. Additionally, PCZ mutation spectra have been related in bone–marrow erythroids and BMGs, however not one of the mutations detected in BMGs have been the identical because the erythroid precursor cell mutations from the identical rats. Thus, mutations induced within the Pig-a assay look like induced after dedication of myeloid progenitor cells to both the granulocyte or erythroid pathway. This text is protected by copyright. All rights reserved.